CcruzaQ_279


Sequence

>CcruzaQ_279 (2 EST) Length=542 GGCACGAGGGTTGCGTCTGGTGCGCCGTGTTGATCCGTGGGCCATTGTGGAGTCGGGCGGGCGATTTGGTCTTTTCCCTA TCGTTTTTACTCGTGATGATCGTCAGGGTTGCCCCAGGATGCGTACAGCAGCACGTGAGGAGCTTGTCAAGACCATATCG CTGTCTCCAGAGGACAACATTGTCCTTGAAGAAAAGGATAGCGATAATATCTTGAATCATGCTGCGGGGGTGGCCCCGCC ACATGAGACCAAACAGGATAAGGCTGAAGTTTTTGTTGTGCCCGGCTGCGGTAGTACTAGCGGCTGCAACAAATGGGCTT GACAACAGTAACAAGATCAGCAGCAGCGGTGTGGAAAACACCACCACCCAAAATACGTGGATTGTAATGCGGCCGCAAGC TTATTCCCTTTAGTGANGGTTTAATTTTAGCTTGGCACTGGCCTCCGTTTTACAACNTCGTGACTGGGAAAAACCCTGGC GTTACCCAACTTAATCCCCTTGNAACACATCCCCTTTCCCCGCTGGTTATACAAAAAAAGCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CcruzaQ_279: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11768042275740AA532208TENF0153T.cruzi epimastigote normalized cDNA Library
17658063244424AI026598TENU0810T. cruzi epimastigote normalized cDNA Library


Date: 9:41:4 on Thu 23 Nov 117.