CcruzaQ_2795


Sequence

>CcruzaQ_2795 (2 EST) Length=282 GAGGTGATGGGTGGATGGTGGCTGCGCGTGTGGACGCGGGGGGAGGCACGGAGAAGAGCCGGGAAGGCAGAAAAGGAAAC ATTGAATGAAAATGAGGCAGGTAAAGGAAAAAAAAGCGAAAAAAAAAAGAGTACAACGAAATGCAAGAGAGGAATAAGAG AAACGACGAGAGTGTTTGAGGGAAGTGAACAAGACGACATGTGAGAGCCTGCCACAAAACCACGGACTTCTGTTCATCTG GTCGGTACTTTTTCTTTTCTGCGGGCCGGGCATGCACATCAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CcruzaQ_2795: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16020532981540AA875710TENU0181T.cruzi epimastigote normalized cDNA Library
17895633299230AI050113TENU1355T. cruzi epimastigote normalized cDNA Library


Date: 10:43:2 on Sat 18 Nov 117.