CcruzaQ_280


Sequence

>CcruzaQ_280 (2 EST) Length=546 TCTCTGGCAGAGGCTTAGTAGATGCCATCCGCATTGTCGTTCGCAAGTCACTGGAAGTAAACGGTCTGGTGCGAGGCCTC TCTGAGGTTGCTCGCGCTCTGGACCGCCGTACCGCTCACATGTGTCTTCTCGCCGCGGACTGCGAAGACGAGTAGTTCCA GCGCCTCTTACACGGTTCATTGGCGTGTGACTCCGACGGGTGCAATTCGTACAGAAACGGTCGTGCGTGACCAGGGCGTC GTCCCCAGTTGACTGTTGACATCCGTTCACTGCGATTCACAGTCGTATTGTTTTGTGTGCAGGGCGCAGTGGACGCCTCC AACTGTGCCCTTTTCACAGTACTGGTCCCGTTTATTCTGANCGGGCCTCGGCTTTGTTCCCATGACGAGGAGGAAAAGGA AGAAGAAGAAAATGCTCGGAAGCAAACCCACAGGGATTTGTCTTCCGATTTGGTGAAGGTGAANTGCATAACGGAACGTT GGGGCCAATATGCATATGAAGAAATTGAATTTGTGTGCNCATAAGTGTGATGAACGTTCGAAAATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CcruzaQ_280: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13815732655651AA675987TENF0498T.cruzi epimastigote normalized cDNA Library
13815742655652AA675988TENF0499T.cruzi epimastigote normalized cDNA Library


Date: 8:59:35 on Tue 21 Nov 117.