CcruzaQ_2813


Sequence

>CcruzaQ_2813 (2 EST) Length=295 TTTGGTGGAAAGAAGGACTTTATAAAGTACACCACATATGAAAAATCAGACATAAATNTTTGCCATGCCTCTGCAGTGGT TAAACTGTTGGAAAAGGGCGGCAGCCAAGTCACAAATTTAAGGTTTATGTCACTGCTCTCCTTATGCTCGCTCAATATGT AATCTCGAATACTTTGCGTTACACCCTCAACAGGAAACGGCAGCGTAGCCTCATCGGTGAGGGGCTTCGAAGTAGCTGCA AGAACGCAATTTTNGTAGAGGCGCTGCCTCGTGCCGAATAGNGGCNACGAGGCCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CcruzaQ_2813: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16889913115761AA952665TENS1849T. cruzi epimastigote normalized cDNA Library
16889993115769AA952673TENS1857T. cruzi epimastigote normalized cDNA Library


Date: 3:53:26 on Sun 19 Nov 117.