CcruzaQ_2839


Sequence

>CcruzaQ_2839 (2 EST) Length=285 GTGCTGTGATAAGGGAGGCATTCTCACTCAGTGCGTTCAGGGCATTCAACATTTCCACCAGGACGAGAATNGACAACGCG ATGGCACGCGCCGTTTCCGGGTCAGCGAGGATGGCACACTTTGCATCCTGCATGTCTGTGCAGGCCGCGTAGGTGGTGAG ATCCTTCCAGTTAAAGCCGTGGCTGAGGAACCACCACAAGAACCCGCCGATGGTGGCAAGGCCAACGTAGACACCAATCA CCATGTAGCGTAGGAACATCCACCCATTCACCCTCGTGCCGANTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CcruzaQ_2839: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16097492991898AA882787TENS0362T. cruzi epimastigote normalized cDNA Library
16945473124123AA958166TENS1702T. cruzi epimastigote normalized cDNA Library


Date: 16:21:57 on Mon 20 Nov 117.