CcruzaQ_285


Sequence

>CcruzaQ_285 (2 EST) Length=544 CCTCGTGCCGAGTTTCTGTACTATATTGAAAGGGAAAAGAGGATAAACAAAACACACAAACACACACACACACAAACAAT CAAACAAAAAAAACTAGCAAAAAGAAACAAGCGGATAGGGGAGTTTTTTTTTTCTTTTGTTTTCAGAGCCGACGTGAGCA GTGGTGGTGGTGGGGGGTAAAGCGGCTAGCGGCAGCGTAACAGCAGGGACAACAACAGCAGGTATTTGGCTTAACACGTA ATTCCACATCTTCTTTAAGAGACATCGGAAAGAAAACAATGGCTGAAGAAGAAACAGATATTTACTTGTCCCCCGCGGAT TCGCACGTGGCGGTGCATGAACACCTGATGCGAATAGAGAGCGCATTTTAACTACTACCCCTGGTGACGCCATGGCGTTG ACGGGACATCCTGCTGACAAGGAACCGAATTCCCCGACGACCGCGGCAAAAGATCTTCCACCTATGTGGTATCGTTTTCT GGGAAACGGGGAATTCGCCCTCTTGACGGAGGCGGGTAGCGATGTTGGCTTGGGAACCCCCACG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CcruzaQ_285: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6786831542817D87301D87301Trypanosoma cruzi Y (Tomoo Tanaka)
18687843482791AI110371TENU3927T. cruzi epimastigote normalized cDNA Library


Date: 11:58:42 on Thu 23 Nov 117.