CcruzaQ_2872


Sequence

>CcruzaQ_2872 (2 EST) Length=279 GAAGCCTTTACGTTGTATTTGAGAAGCGAGTTCTTTCCTTCATTGAGGGAATTCTTGCTCACGGCCAAAGCGACCCAGCA CCCTTGGGCCTCGTGACAGACTCGCTCCGTCGCCTGACTGCTCTTCTGCAACATGTACTTGCCTTCAATTGGGAGCTATA TCAACCCTTCTACAGGGAAATGCTTTTGCTCATCACGCAAGAAGATGCTGTTAGTTCATGAAAAGGGGTAATACGGATAC AGATACTCTGCAAATGTTTATTGTTTTGCTTTATCTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CcruzaQ_2872: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18303423404618AI075497TENU3090T. cruzi epimastigote normalized cDNA Library
18303493404625AI075504TENU3098T. cruzi epimastigote normalized cDNA Library


Date: 1:45:5 on Sat 18 Nov 117.