CcruzaQ_2886


Sequence

>CcruzaQ_2886 (2 EST) Length=308 AAAAGCCAGTNATAGACATGAATTCATACAGAAATTAAAATACGCAGATTNAAAAATATACAATTCGCAACCAATCATTC GCCTGTTTAGCTTTTGAAAAAGATGTACATAGCAGATTGCTCTCGCTTCCTTCTCCAACAACCTTACACACTCTCCCCTA TTATTTCTCTAAAAAGTTGCGCAAGACATGTCTCGGACTCGTCAAGTCTCAGAAAATTTCCATCTTTTGTTCCGTTTCCG CATTTATTAATTTTCCCGTAACTTTCTCACGCCTTCCAGGAAAAAAAAAGAAAAGACAGAAATAGAGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CcruzaQ_2886: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10776692130852AA433375TEUF0025T.cruzi epimastigote non-normalized cDNA Library
17926293320965AI053338TENU1500T. cruzi epimastigote normalized cDNA Library


Date: 4:28:8 on Fri 24 Nov 117.