CcruzaQ_2942


Sequence

>CcruzaQ_2942 (4 EST) Length=520 CACGAGGGCCAAATCCCTCGTCTTCCAATTAGAGACGCGCATGAATGGATTAATGAGATTCCCTCTGTCCCGAGTTACTA TCTAGCGAAACGACAGTCAAGGGAACGGACTTGAAGGGCTAAGCGGGGAAAGAAGACCCTGTTGAGTTTGACTCCAGTCT GGCTCTGTGCGGCGACATCTGAGGTGTAGTATAGGTGGAAGCGCAAGCACAAATGAAATACCACCACTTGGAACGTTGCT TCACTTATCGAATGAAAAGACCAATGGGTTTCGCGTAGTCTGCGGGCTATGCACCGTCTAGGTTTGGGATTTTTTTTTAT GGCGGTAACCCCGTCTCCACGGGAGGTTGTGTGTATATGTATGTGTGTGTGCATTGCACAATATATGTATGTTATATGCG ACCGCGTTTTATTATCTACCGATCACACCACAGGGGGGCACGGTCCGTGTTGTTCTGTGTGTGATGGCCCGTGGGCACCC AACCGCGCCGACAAACTGAACCAACGGGTTGCTTCGGCAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CcruzaQ_2942: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13815532655631AA675967TENF0455T.cruzi epimastigote normalized cDNA Library
13817742655852AA676188TEUF0156T.cruzi epimastigote non-normalized cDNA Library
13817852655863AA676199TEUF0239T.cruzi epimastigote non-normalized cDNA Library
16889983115768AA952672TENS1856T. cruzi epimastigote normalized cDNA Library


Date: 5:1:33 on Sat 18 Nov 117.