CcruzaQ_296


Sequence

>CcruzaQ_296 (2 EST) Length=579 TCGGCCCACGTTGCAGTGAAGCGAAATATTGTGTCGACGTACCTGTCCGGACGCGGGCTGTGGTCCCCTCGCATCCGGGA TAAGTTTGATGGACTCGAGCAGTATGGATTTACAAAACTTGGCTGCATCTATCACGCACAGGACTTGGCGGTGCGCTCCT ACACGAATGCCTCAAAACCATTTGCATCTATGACACCTGCCACAGTCGCCTCTATCCTAACGCCTAGCAACGGCAGAGCT CATAAAAGTAACAGTAACGACGGCAACAGCAATACACCGCGGTACACCACATGTGTTGCGGTTCCTGGTGGCGTCGTGAC AAATCTTTACCGTTATGTTCCCCTTGCCACGACGTTTCGTTGGTGTCGTTACTTTTATCTGCTCTTCATGCGCACAGCTA CTGAGGGAAGTCAAGTGGTTGTGAACTGTTGCGTGCGGGAGGAATTAGTGAATGGCGGTTATTATCAGAATTGCCGCTAC AGCCCTACAGGCCTTTCCGCTACCGCTTGCAGCGTAGAGGAACGAAAAAGTGTGCTGGCATGGGTGAGGCTAAAGATGCA GCCGTACATGCGGTGGGAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CcruzaQ_296: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18056553366312AI066147TENU2538T. cruzi epimastigote normalized cDNA Library
18336713415185AI078913TENU3631T. cruzi epimastigote normalized cDNA Library


Date: 8:14:22 on Wed 22 Nov 117.