CcruzaQ_2968


Sequence

>CcruzaQ_2968 (2 EST) Length=277 CGGTTGGGCTGGGCGGCATCAGCGTCACTATCTAACGATTTCTCCGTTGGCTCTTCAGCGACACACTCAGATTTCCCGAG TTACATACATAAGAAGCTCCTCATCACGTGCTGCCGCAGTGCGAGATCATTAGCGGGGAGTGCGTGGGTGATCGCACACG CAGCTGACCCCTGGCGGTGCGGAAAGACCGCCCATTCCACTTGCGCACAACACCCGCTCAACCACAATCACATAACTCAG TTTACGGCCACAGATGAGCAACAAAGTGACGACACCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CcruzaQ_2968: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16095952991744AA882633TENS0204T. cruzi epimastigote normalized cDNA Library
18057743366431AI066266TENU2382T. cruzi epimastigote normalized cDNA Library


Date: 10:8:37 on Fri 24 Nov 117.