CcruzaQ_2971


Sequence

>CcruzaQ_2971 (2 EST) Length=273 AAATCGGCACGAGGCGGAAAAGGCCCAAAAAAAGGCGGAAGAGTACAACCTTGTGTTTATGGAAGTTAGTGCTAAGCAAG GAAAAAACGTCAAGGCACTCTTTAAAAAAATGGCGGAGGCTCTCCCTTTGCCANACAACAACGCGAGTGGTATTGGCAAN AAAGGAAATGGTGTGGGTGACAGTANCAGCCANCCGTTTGTGTTGGGCAAACAGCGGGATCCATTTCTCCTCACCCCATC GCGGCTTCCACAAAGTGATCGTGATGGATTGCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CcruzaQ_2971: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16888283115598AA952502TENS1440T. cruzi epimastigote normalized cDNA Library
16945313124107AA958150TENS1686T. cruzi epimastigote normalized cDNA Library


Date: 19:26:56 on Fri 24 Nov 117.