CcruzaQ_2987


Sequence

>CcruzaQ_2987 (2 EST) Length=275 GCTCGACAAGTGCCGTGAGTTTGTTCTGAGGGTGGCGGAGAGCCTCAAGGCGTCCCCTGCCCACCTGTGACAATGTTGCC ACCGCCAGTGTGCTGGGGCGTTATATTTACCTGTAATAGGTTTTTTTGTTGAGCTTCTTTCTTTTCCTATTTGTTTCTTG GATGGGTGGGTTTGGGCTATGATTGGCGTTGAGCGTTGGTNGCGGGAGGACCGTCATGGCGTCGTCTCAATTTCCACACC GCCAGCTGAATGCGGGGGAATGGTCAGGGATACAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CcruzaQ_2987: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10860542153638AA441760TEUF0535T.cruzi epimastigote non-normalized cDNA Library
13817922655870AA676206TEUF0537T.cruzi epimastigote non-normalized cDNA Library


Date: 5:52:52 on Sun 19 Nov 117.