CcruzaQ_302


Sequence

>CcruzaQ_302 (2 EST) Length=539 GGTGTGGAAGACATGGATGTGGGACACTGCCATTGCGGATCATCAGAAGGCCCGGGTGCAGCGCGGGAATGATTGGCGGC CAACGCAAAGGATGAGGTTCGGCTTTGTGACATTCTTCTTGGGCCGAACTGGGACTTGCGTGTGTTTGAGCCCATGTGGA AAATTATTCCCAGCAACAAGGCTATCCTGCCCATTATTTACAACAAGCACCCAGACCATCCAGCGTTGCTGCGGGCCAGC TATGAACTCACGGTTGAGCTGCAGCGCACCGGTTACGTGAAGAAGCCCATCGTTGGTCGTGTCGGTCGAAATGTCACCGT CACAGAGGCGTCTGGTGACATTGCCGCGAAATCGGATGGAAATTTTTCGGACCGCGACATGGTCTACCAAGAGCTTTTTC GCCTGCCCGAGAGGAGTGGCTACTACGCCATACTCGGCGGCTGGGTGATTGGCGATGTCTACTGCGGCACTGGTGTCCGC GAGACAAGACAATCATTACGGGACTCGAGTCACCATTCATCGCCCTTCGAGTGTATCAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CcruzaQ_302: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18280253399482AI073288TENU2959T. cruzi epimastigote normalized cDNA Library
18416143421657AI083234TENU3912T. cruzi epimastigote normalized cDNA Library


Date: 23:14:45 on Mon 20 Nov 117.