CcruzaQ_3074


Sequence

>CcruzaQ_3074 (2 EST) Length=267 AAATCGGCACNAGGGCGCGAGAAAGCTGGAGCTACTGCTTTGGTTACCTCTGCTCCCTGTACTACGCCCAAATTTCCCTT CGGGAGCAGCGGAAGCGGTTGCAGCAGCGGGACATTTTCTCNCACAACATCATGTCTGCGCTGGGCAGCTCGGAACAGGG GAAAAAACACACGGTACNCCTCNCCCGAGGACTTGGCAGCGCCTACTTTGAGCTGTCCTTTGCCGTGGACTCTCTCCTCA NCTTTACACAAAACATTGTGGGCATCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CcruzaQ_3074: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16188463017694AA890815TENS0663T. cruzi epimastigote normalized cDNA Library
16888583115628AA952532TENS1467T. cruzi epimastigote normalized cDNA Library


Date: 20:45:35 on Thu 23 Nov 117.