CcruzaQ_3079


Sequence

>CcruzaQ_3079 (2 EST) Length=269 ACTATATTGACGTTATTGTCCCCTCCCCTCTCTCTCTCTCTAATTCAGAACAAATTTTAACAAATGCACCCGGAAAGACT AAAGGCGTTGCGTGAACTCTCGTCCCTTTTGAAGGAGAAGAAGGATGTGCCGCAGAGGTAGTAGGGTATGGCTGGCATGA AGGTCGGTGCACGACTGAAGGATGTAGAGAANGGAGATTGTTGCCATNAAAAAGAACGTGTCGAANGACATTAATTCGCA GATGATGGAGAATCAGCAGACAATGTTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CcruzaQ_3079: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11767062275642AA532066TENF0352T.cruzi epimastigote normalized cDNA Library
11767492275685AA532109TENF0466T.cruzi epimastigote normalized cDNA Library


Date: 6:21:34 on Thu 23 Nov 117.