CcruzaQ_3083


Sequence

>CcruzaQ_3083 (2 EST) Length=367 CCACGATTTTATGCCATATGAATTCTTATCCTAATTCAGGTAAATGTACATAATTTTGGCCGTCGCAAGCCTGGACTTCT CGATGTTTCCCTCCTCTCTACTAACGCAACATCGTTTTTGATGATTCTGCCATGTTAATACTCTTTCCCTCCTACACGCG CCTCTCCAGCAAATTAAAAGCAATAGAAATAGTGACACGGAAACGGCGCAACAGTCAAAGTCACTCCGAAAGAAATGCGG AAAGAGCCCTCATCCTCTCAGGGGCAAGCTGCTCCTGCAGCCTTTTATNTATNTCAGCTTGGTAAGAATTCGCCACATTA CGCCGCTCCCACTTCCCTCGTGCCGANTCNGGGCCTCCGAGGCCAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CcruzaQ_3083: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16189303017778AA890899TENS0749T. cruzi epimastigote normalized cDNA Library
18046513340603AI065196TENU2076T. cruzi epimastigote normalized cDNA Library


Date: 21:55:54 on Sat 18 Nov 117.