CcruzaQ_3088


Sequence

>CcruzaQ_3088 (3 EST) Length=490 TATTATACATATTAACTTGACACACACTCAAGCAAGCACAACAACACAACACAAAACAAATACATACACGCGTTTTGTTG TTGAGTGGGCATCTGGTCTTGGGACTGGCTTCTGGCTTAGAGGCGTTCAGCCCAGAACCACCGTGCGATAGCGTCGGAGC ACTTGCCGTTCGACAAACTCCAGAAACCAGAGGCACGGCATGGGAGTTCCTCTCGTACTACCCCATACTTCCCTCACGAT ACCTGCGAGATCCCTTCACAATCTCACACAATAGAGAATATATATACATATATATATATCATATTTCTCATTGTTTGTCG CGCTTATCGTTTTTTTNTCTTTTTTTTTTTTTGTGTGTGTTTGTCTCCGATAACTGGCCTCGTCCCATTGTGATTTATTT AAGGATCTGGGGGCTCCCTCTACAAGGGAAAAAGTGGGAGCTTCAAATATGTGTGTTTGTTTCTGATTTACCCCATCTCT TGGTTTTTCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CcruzaQ_3088: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13817582655836AA676172TEUF0073T.cruzi epimastigote non-normalized cDNA Library
17770693269242AI037818TENU0849T. cruzi epimastigote normalized cDNA Library
17927663321102AI053223TENU1648T. cruzi epimastigote normalized cDNA Library


Date: 12:47:52 on Fri 17 Nov 117.