CcruzaQ_309


Sequence

>CcruzaQ_309 (2 EST) Length=778 TGGCCTCTGAGGCCAAAAATCGGAACNAGGGCTTGTCCGTCTGCAGGGCTACTGCTTCGGAGGTGAATTTTACCATTGCG CCGGCAAAACCATTGGCTGATGTGGTAGTGTTTTGTCCGGGGACTGACGGTAATTTGCGTTGGCGATTTCAAGGCGAGAA GGACTGGCGAAAGTGTGCGAGGAGGCCCGAAAAAGCCCCGGAAGTCAATGGTTACTGCGCNCGGCTATNCAATTTCGCTG GAAACATATACNAGGAACCCGAAATTACCANACTGTGCAATTCTGCCNNTAATAANAATTTTGTTGCCTTCCATATGTCN TTTGAGAAGCACGANGATCTAAAAACCTGCACTTTGGTGGAGGCACCCGAAAACTCCAGTCAGTCGTCCTCCGCCTCATC CGGCGACACCACCACTGTGTGGGTGCGCACGCCTCTGCTGCCGCTGCGGCTCGTCACCGCCCTTGTCTGTGCCGCCGTGC CGGTGATTAAGAATAATCGTGCATGTCCTTGCCGGGGGACGGCTCCTACTGTGTGTGTGTTTTCTTTTTTTCCTTGCTTG CTTCTGTTGCCCACACGCGGTGCCGGCCTCACTGCTGCGCGTCCCACGGACTGCACGAACGAGGATTGGAGGAAGAGGCC GGATGCCGCATGAAATGTGAGGAATGTTGTGTGGGGTAGTGGAATAATGCGATCCCTTTATTATTATTACATTTTTCGTT TGTGCAGGTGATATGTGTGCGCACCCGATCGTCTTTGGCCGCATGGACATGCAATTCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CcruzaQ_309: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16580913073610AA926474TENS1096T. cruzi epimastigote normalized cDNA Library
18414793421522AI083099TENU3776T. cruzi epimastigote normalized cDNA Library


Date: 22:13:26 on Sat 18 Nov 117.