CcruzaQ_3114


Sequence

>CcruzaQ_3114 (2 EST) Length=291 TAACTATTAATTGGTAAAAGTTCATCTGTGATTTGCGGCATGGTAAAACATGCCCAACGAAGCGTAGAAGCATGGAAGGA GAGTAAGTGGAAAGGTGAAGAAAAGAAACAAAACAAAAGGATAGAAAAACAAGAGAGAGAGAATGAGAGAGGGTGCGTGT AGGGTGTATGTGTGAGCTCGGTGTGGTGGGAGGCGGCGTCAAATTATTAGACTCCTCTACACTCGCAGAAAAAAACACAC TCGCATGCAAGCACGCACGTACACAAAAAAAGTGTACCGCCTCAGTACTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CcruzaQ_3114: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17826373286559AI043302TENU0942T. cruzi epimastigote normalized cDNA Library
17827883290235AI043452TENU1011T. cruzi epimastigote normalized cDNA Library


Date: 14:33:53 on Sun 19 Nov 117.