CcruzaQ_3121


Sequence

>CcruzaQ_3121 (2 EST) Length=287 AAATAGGCACGAGGCTTTTTTTTTTTTTTGAACCCCTTCTGTTTGTTGGTTTTGCGTTCCCCACTGTTGAGTGTTTTTCT TCGCTTTGCAGGCATCAGGGGCATCACTGTTGTAATTCTTGAAANTGCCCGCAACTTCCCGCCCTGCGGCAAATAAATAA ACGGATCAAAAAAATTGCTCTCGCCTTTTTTTTTTGTTTTTTGGTTTGCTTGTTGTTGTTTTTTTTNCTTTTGTTTTTTG AAAACGTTTTGTCTCTCTCTCTCTCTCTCCTGCTTCGTGTTGGTGTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CcruzaQ_3121: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16095222991671AA882560TENS0131T. cruzi epimastigote normalized cDNA Library
16889023115672AA952576TENS1760T. cruzi epimastigote normalized cDNA Library


Date: 21:25:10 on Sun 19 Nov 117.