CcruzaQ_3157


Sequence

>CcruzaQ_3157 (2 EST) Length=365 GCGAGTTTCCCTCTAGAACGAAGGAGTGAGTAAATAACTTTACTGAGGAGGGGGGAGGGGAAAGACAACCGTCCTTCGCA TGTACGATAGTAACTTTTGCGAGTGTTGAGGATATTTTATTTTATTTTATTTCTTTGAGGGAGGTTTATTATAGGATTCC ATTTGTTGATGTGATTTGATGTTTGATACGTNAATNTTTACGCCGCGTCTGTCGTGCGTGCCCGGAGTTTATGTCTCTTT TGAATGTATGCACCTATTTCTGTATCCTTTTTTTTACTGCTTTTCTCTTTGTTTTTTTTTNTTCTTTTTCTTTTTTTTTT TTTTTTCGTTGGTGCCTGCTGGGGGTGAATTGGACCGGAGGGGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CcruzaQ_3157: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10776502130833AA433356TEUF0215T.cruzi epimastigote non-normalized cDNA Library
13816262655704AA676040TENF0559T.cruzi epimastigote normalized cDNA Library


Date: 6:13:56 on Sun 19 Nov 117.