CcruzaQ_316


Sequence

>CcruzaQ_316 (2 EST) Length=595 TAGGCGCTGACAAACACGCAAGCACATGCATACACACACACACACACACACACACACCATATCGTTGTCGCTTTGGAGCG GCGTGAACGCTGAGGACGCACGCACGCTGCGGATGGTCACGGCGGACACTATGGGCTCCGGTGTGTTGGCGCCTGCGGTT TCTTTTGGCCACGCTCACATCCACAGTGTTGGAATCTCCGGTTTGGTCGTGGGTAGTTGGAGAGATCAAATGCGAACACG GTGACTTTCACGCCGTGGGCTCACAGTAACCCTTTGGCCAGTGGCATTGCGGAAGAAACTGTCATGATAATTGCAAAGCC GTCACGTCTTGTTTTCGAGCATCCGCAAGAGAAGCAGTAAAAACATATTTGTTCCGCATGACTCTTTCCATCCCCGCCCC AGGGCTGCCCATCACAATTGAGGTTACCGTGCGGTGGCGTTACCCATATGAACTCTTGGGAAAGAAAGAGAGAGCCCTGT GCGATGCTCCCGCACCTGGAACGGACGCTGCACAATTGGTGGCTGTTAAGTGGCCGGCCACACGATTATTGCTACACCGC GAGGAGAGCAGACGAAACACTCCGCGTGTAGGGAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CcruzaQ_316: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17854073293913AI046280TENU1150T. cruzi epimastigote normalized cDNA Library
18056603366317AI066152TENU2543T. cruzi epimastigote normalized cDNA Library


Date: 2:51:42 on Sat 25 Nov 117.