CcruzaQ_3225


Sequence

>CcruzaQ_3225 (2 EST) Length=255 TAAAAGAAAAAAAAAAGAGCACAAAACAAAAGTACTCAACTTTGACGGAAAAACACCCACTAAATTCATCACGCGCCAAG ATGCGGCAAGGCTCACACCAACGGGCCGCTCTTGTCGTTGAGGCGGCTGCGGCTCACGTTGGCGTGCCGCACGTTAGTTG CGCGGCTTCTCCTTCTTCTGGCGGTAGAGGGCGTAGAGGCCGACGTTCGACACCTTCACGATCTTGAAACGCACTCCGGG AATATCGCCGACGGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CcruzaQ_3225: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16061672988291AA879326TENU0226T.cruzi epimastigote normalized cDNA Library
18046363340588AI065181TENU2061T. cruzi epimastigote normalized cDNA Library


Date: 4:18:16 on Wed 22 Nov 117.