CcruzaQ_3239


Sequence

>CcruzaQ_3239 (2 EST) Length=251 GGCCGCGTTTGATTGCCTACAGTTGACGATGTTCGTGTATGCATACCCGTTTCCTTCTCCTCTTCTTTAAAGCGTATACA TACCCTCAGTTTTTCTTCCTCCTCCCCGCCAATCTTTTTCTGTCCACTTTCGCGCTCCTTTTATGGCATTGTTCCCCTTT GTTTGACTGCAGCACAATCACTTCTTTCATTGACTCCATCGCCAACCGGTCTCGCCGCGTCTCGCTCAAAAGTCATTTTG TTTTTTCTCTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CcruzaQ_3239: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17927373321073AI053194TENU1618T. cruzi epimastigote normalized cDNA Library
18687613482768AI110348TENU3319T. cruzi epimastigote normalized cDNA Library


Date: 15:40:15 on Fri 24 Nov 117.