CcruzaQ_3259


Sequence

>CcruzaQ_3259 (2 EST) Length=253 TATTCATCNTGCAGCCGTTTCCATCGTGTACACACACACACATTGTAAGTTACCCGGCGTTAACCGCCATGGAAACAAAA AACAAAAAAACAAAAGTGTCCCACGTGGCTACTCTTCTGCGCTCCCTCACTCTCCTCTTGACCCCGGGCCTCCGCCCCTT CCTCGCTGCACCCAAAAATAAAGGGAGGAAGGAGGAGAACCCNTGTTTTTGGGGGTTTTGTTATGTGCCAAGCCATGCGT GCTGCGGGGGGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CcruzaQ_3259: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
14534752772464AA738503TENU0012T.cruzi epimastigote normalized cDNA Library
14534762772465AA738504TENU0013T.cruzi epimastigote normalized cDNA Library


Date: 22:25:4 on Thu 23 Nov 117.