CcruzaQ_3316


Sequence

>CcruzaQ_3316 (2 EST) Length=262 CCGCACAAGAGGGTGAAANTGGNGGAAACCGAACGTGAGACGACGTCAGTGATAAGGAACTCAGGAACCCTTTTCCCTTT TTTTTCTTCTCCCGCAGACCCTTTGTTTTTTTTTTATTTTCTTNACGGTTTCTGCGTTTGCCAATCAGAAAAGAACATTT TATGGGGAGGCACATATATGCGCATTATATATATATTAGGTTTTTTGAAAAGTGTTGGGTTATGCCTTTGCATGCCGCCA CACGTTTTTTTTTTTTTTAAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CcruzaQ_3316: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16096932991842AA882731TENS0306T. cruzi epimastigote normalized cDNA Library
16580533073572AA926436TENS1058T. cruzi epimastigote normalized cDNA Library


Date: 6:14:6 on Wed 22 Nov 117.