CcruzaQ_3319


Sequence

>CcruzaQ_3319 (2 EST) Length=342 CGGGGGAAACCCGCAAAGGGCCCTTTTGATGTGGATGGCAGGAGAGCACGGCGACAGGCGTGGGGCACCGCTGAGGGTAG GATGCATACCACTGCCAATGGAGTTCCGCCTACTGCTCTTGCCTTCTTTCCAACTGTAGAGGAGGAGCTGGAGTGCCTTG TTGAATGCGCCATTCATCTTTTCCTAGAGGCGCTGTTGCTGTGTCGTGCGTTATCGAGTGATTTCATACCACAGATCGAT GCGTGGGCGACGGAAGTGACGTCCAACACAGTTGACCTTGCCCTTGCCACTCCCCTCCCTGTTGTGCGGCACCTGCACGC TGTCGGGTACGCCCTTTGTCTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CcruzaQ_3319: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17459483216889AI007379TENU0399T.cruzi epimastigote normalized cDNA Library
17827953290242AI043459TENU1018T. cruzi epimastigote normalized cDNA Library


Date: 8:23:36 on Thu 23 Nov 117.