CcruzaQ_333


Sequence

>CcruzaQ_333 (4 EST) Length=764 AAAAGGTCAAAAAACTACAAAAAGAAATTTTTCAAAAGAATAAAAAAAAAACAGATTTGCTCCATCAATCACCTTTTCGG AAAAGCTTTTACTTCGACGCACGTTCGCGGATGCTCGCAACCAAAAATGCGATTTTCTCCTTGGCGGCGGCCTTCTTCTG GGCGCCAGTCCGTTTCGGCGTGTTGTACTTCTTCACCGCAGCTCCCTCCTTGCGCTCCTTCCTTGCGCGACGCTTCATTG GATCCGCGCGGATAGCAGCGTGCGCCTTCTTGTACATGCCCTCGAGCTCGTTGGGAACAACCTTGTCCTTGATGTACTTT GAAAACTGGCACGTGCTCTCCTCGGGGTTGGAGCTCGCCTCCTCACGCACCTGCTTCAGGTATTCAGCAACGTGCAGGCC CAAGATGCGGTCGCGGTGGGCCTTGGCGTTGAGCGAGTCCTTCTCCTTGTCGTAGCCGGGGAAGCGGTTCGGGCGGTGAG GCACAGCCAGGCCGCCGTCCACCGCACCCTTCATGACACCAAACACACGAGCACCGGTTCGTCGTTGCGGGCGAGTCCAA CGTCAAGAATGGCCTTGAATGGGAAGCGCTTCTCGTCGTCGCCCTGATCGTCGGCCTTCGTACGCACGGCCGAGTAAGAG CCGTCCGCCTCCTTCGTGCCCTCGAACTTGTTCGCGAGGCCAAGCTTCGTCAGCATGCGCCGCGCAACCAGCAGACCTGT CGCGTACGCCGCCGCGTAGTTCGTCAGGCCCCTNGTGCCGAATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CcruzaQ_333: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13817762655854AA676190TEUF0167T.cruzi epimastigote non-normalized cDNA Library
16361443046185AA908113TENS0953T. cruzi epimastigote normalized cDNA Library
18337113415225AI078953TENU3671T. cruzi epimastigote normalized cDNA Library
18416233421666AI083243TENU3923T. cruzi epimastigote normalized cDNA Library


Date: 16:47:20 on Wed 22 Nov 117.