CcruzaQ_3353


Sequence

>CcruzaQ_3353 (2 EST) Length=368 AGGGCACCCCAACACACACCCACNCCCCAACGGCCAAAGAGGCCGGACCCCCGGAAAACCAAGAAAGGCCCGCCAAATTT TTTTTTTTTCCCCGCAAGGCGCCCCGGTTTTTTTTTTTTTTTTTCATTCNTTCTGNTTTCGGTTTTTTTTTTTTTTTTTT TCGTCTTAAGATGCCTGCAACAACTCCAACTGCTTTTTCACCCAATTCATTTGCCCCTTCGTCTCCGCATCGTTTTCCAT GTTGACCGCCCGCCCCACCACTTCCCGGTACCACATTTTATAATATAACTCAGAACATTATCATTACAGTTTGACACATA TTCAACATAACACTCTATTACTCTATCTCTTGTCTCTATTATCTGTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CcruzaQ_3353: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10776702130853AA433376TEUF0250T.cruzi epimastigote non-normalized cDNA Library
10860582153642AA441764TEUF0058T.cruzi epimastigote non-normalized cDNA Library


Date: 15:15:3 on Wed 22 Nov 117.