CcruzaQ_3382


Sequence

>CcruzaQ_3382 (2 EST) Length=227 GTACTATATTGGAGTCAACGTCACACAAACACCTCACGCAACACACGATGAGCTTAGAGCTTCGACTGGGTAACCCGCTT CCCGCCTCGGCAAGAAGATTGGCGGCGGGGTCGTCCGGCGAGATCTTCCGCCGGCAAAAACATACAGACGGGCGAGACCG TGGCCATCAAGCTGGAGCAGGTGAAGACGNGNCATCCACAGCTTGCCTTTAAGGTCCGATTCTACCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CcruzaQ_3382: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10776212130804AA433327TEUF0173T.cruzi epimastigote non-normalized cDNA Library
13817552655833AA676169TEUF0068T.cruzi epimastigote non-normalized cDNA Library


Date: 2:49:16 on Thu 23 Nov 117.