CcruzaQ_3387


Sequence

>CcruzaQ_3387 (2 EST) Length=223 CCGCTCACGCTGGCGACAAAATCCTTTCAATTTTGTCGTGACGCCACCAGCCCGATTCCCATGACACGAGGACGCACGCG CAGACACACAGCCACGCCCTGGCGAATGGGGGAGGGGCGGTGAAAAGGCGCGGATGTGCGGTTGATGAGTCATCAGAAGT TTCTTTTTTTTTTGTGCGTTGGGCGATGTGGCTGCGTGGCGGCCTGTTTGTGTTGGGTGGACG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CcruzaQ_3387: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13815892655667AA676003TENF0517T.cruzi epimastigote normalized cDNA Library
13816042655682AA676018TENF0532T.cruzi epimastigote normalized cDNA Library


Date: 6:57:38 on Mon 20 Nov 117.