CcruzaQ_3429


Sequence

>CcruzaQ_3429 (2 EST) Length=215 CTCNGAGGCTTTTAATCGGCANGAGGGCAGTATTCTCCTCAGCTTCGGCTCCCATCCCGATNAGTGGTGGGGGGAGGGAC CGGGGCGGGTTTGTTGCTGTTACTTTTGCTGTTGTTGGGGGTCGTGGTGGTGGTGGTGGTAAAACCCAAAGTGAAAAAAA GGCCGTCTCCCCCAATAAAAAATGCTGCATTTTGTGGTGATCATGCANAATTGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CcruzaQ_3429: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16360943046135AA908063TENS0903T. cruzi epimastigote normalized cDNA Library
16945103124086AA958129TENS1665T. cruzi epimastigote normalized cDNA Library


Date: 4:34:16 on Sat 25 Nov 117.