CcruzaQ_343


Sequence

>CcruzaQ_343 (2 EST) Length=559 TCCGTGCGCGGCCTCCACACCAATAGGCGGAGAAAAGAGGACACGGCTGGGCAGTTTTGCCGCCCACTCGTAGGGCCCGG CCATTCCCCCGCAGCAAAAATGAATAATAGTAAAACCCAGGAGAGGCCTGTCTGCGTGGAACGCCGCAGCGAGGGTCCTC GTCCCCGCCCTCAGCACAGCAGTCACGGACACCCCCGCACCCATTGGGTCACAACGACTTCCCATCGCCTGCCCGCATCA GAAGACGCACGTGGGTGCATGCGGTGCTGGGACTCGTCTCCTCCCTCCAGACCACCTCGCCACCACGCGGTTGCGCAGAA ATTCATTCCGCCAGCACACAAATGTCCGTTAAGCCACGCATCGCAGGCACAAGAAAATTAATATACTCATCGTCCGTTTT CCAAGAAGCAAAGAGAGGAGTAGCGCAACAGTTGCACGATGCTATTGTTACTCGCAGTGCTGCGTCTCGCGAGTGCGGGG CCGACGGGCCATGTGCACATCACGACCCTGCCAAACGCTGCTCGCGCATTTTCTTTTTCTCGTTTTGCTCGTGTTTTCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, Processing,


Cluster Information for CcruzaQ_343: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10776342130817AA433340TEUF0197T.cruzi epimastigote non-normalized cDNA Library
18386323417044AI080792TENU3500T. cruzi epimastigote normalized cDNA Library


Date: 10:6:10 on Wed 22 Nov 117.