CcruzaQ_3431


Sequence

>CcruzaQ_3431 (2 EST) Length=279 AGGCCGAACAAAACTCTCTGCGGGCGAACATGCAATGATGGAGCTGGGGAGGGAAAAGGAAGGAAGGAAGGAGGAGGAAC GCAACGAAGGGGAGTGGAGTNTCCCGCCCAGCCGTGGTGTCCCTGCTGATGCTGCAGACTCTTCAATTTTATTATTTTGC CGTTTCCTATCTTTTTCCTGGGTCGTGTGTCGTGTGTGTCGTGTGTGTGTGTGTGTGTGTGTGTGTGATGAGGGAGCGTC TTGCTTGGGGATGTCAACTCGTAAATGTCATATGGACGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CcruzaQ_3431: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17854473293953AI046055TENU1091T. cruzi epimastigote normalized cDNA Library
18058763366533AI066368TENU2484T. cruzi epimastigote normalized cDNA Library


Date: 23:44:47 on Sat 18 Nov 117.