CcruzaQ_3493


Sequence

>CcruzaQ_3493 (2 EST) Length=356 CTACGATGTTTGTGATCCCCACTTTTATCTCAGTTCTGCGGTCAGCGTGATACCATTCACCGTGAACAGAGCACCTTCTC CACCGCGTGGTACGTAGTGTTATAGTTCTTTATTTTGTTGCGCTTTTATGTATTTGCCTTTTGTTGTTGTTTTTGTCCTC GTTGTTGTCGTTTTCGGTTCATTTTTTTTTTTTTTTTTTTTGGTTTCCTCCGTTTTGAGTCCATTCCTCCCTCCGCAAGC AAATTTCACCCAAATCCGCACATACACGAAAGAAAACAAAAAAAACTCCACACGCCACCGCTCTAAAAATGCATGAAACA GGCACCCGTGCAACTACACCCTCTTGAGTTGCATAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CcruzaQ_3493: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17826613286583AI043326TENU0967T. cruzi epimastigote normalized cDNA Library
17928013321137AI053258TENU1685T. cruzi epimastigote normalized cDNA Library


Date: 5:4:54 on Tue 21 Nov 117.