CcruzaQ_3531


Sequence

>CcruzaQ_3531 (5 EST) Length=552 AGTCCCATCGCAAAGCGCCCAAAAGCACTTCAACAAACAAAAAACAAAAACAAAAAAAAAACAACATATTTACTAGCATG CAGAATTTTCTTCTTCCTTTCTTTTCTTTTTTCTTTTTTTTCTTCTCTTGTGGCCACAAAATACATCATTGCCTTCTTGA GCTTTCTATTTCCCTGCCCCTTCGTTTTCTTTTTTTTTTTCTTTTTTCTTTTTTCTCTCGTGATTTTTTGAACCATTTTC TCTTTCTTCTCCCTTCCTTTTGTTTTTGTTTTTCTTTTTTCGTTGGATTTTCTCCTCATTTTCCCACGTATTCTTCCCCT CACGCCTCTACTCTGTCTTTCCACCGCAACGATCCCCTGTCACGGAAACACAGTACAGTGGGAGTAGCAGTCGTGGCGAT GGCAGGCAATAAACCCTGGCGAGAGGGCGGGTCAGACCGAAAGTACAAACAATAAAAATAACGTGTATATATATATATAT ATAATGCCCAAATTTTCCTCTTGGAACTTTGTTTTTTTTTTTTTTTCTCGTTTCCCTTCGGTTGCTTCTCTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CcruzaQ_3531: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10776412130824AA433347TEUF0203T.cruzi epimastigote non-normalized cDNA Library
17826243286546AI043289TENU0929T. cruzi epimastigote normalized cDNA Library
17854103293916AI046283TENU1153T. cruzi epimastigote normalized cDNA Library
18057613366418AI066253TENU2369T. cruzi epimastigote normalized cDNA Library
18414883421531AI083108TENU3785T. cruzi epimastigote normalized cDNA Library


Date: 13:59:56 on Mon 20 Nov 117.