CcruzaQ_3532


Sequence

>CcruzaQ_3532 (2 EST) Length=196 GTTCTGTATTTGCTGTTTGCAAAATACACCCATTTGTGTGGCGGTGTCCATTTTATATGTTAGTATGCGTGTGGTGCTCA TTTCTGCTGGGGTGGCGGGTCTTCAAATTTTTTCATTAGTTCATTATGTGCATATTTTTGTGAGTCTCGCGTGCCTGCCG CTGCGTGTAATTTGTGCGGCTTTTGTGCCTGGAAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CcruzaQ_3532: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17854943294000AI046102TENU1188T. cruzi epimastigote normalized cDNA Library
17895933299260AI050143TENU1388T. cruzi epimastigote normalized cDNA Library


Date: 14:42:43 on Tue 21 Nov 117.