CcruzaQ_359


Sequence

>CcruzaQ_359 (2 EST) Length=403 ANTCGGCACNAGGCTGAGCCGAACCGTTTATCTTTTCCCGCAGCCCTTTCTTGCGGAGGTGGGGAGTAGGGCCCTATTCA GGCGCGTGTTTTTATTTCGTTGCCACTATTTTGTTACTTTTATTTTTGTCTANCCTACTTATATATTTATATATTCGGTC ATCAAGGGTGATATTTGCGCCTCCCATGCACGTTGTGGTCGGCGGAGGATATGTTGATGGCCTTCAAAACGCACCCGCAC AAGCACACACCACTTAAATGTATTTGTTATGCTTGGAAAGCAAAAGAANAAAAATAAATAAATAAATAATTGATATGGGA CAATAATATTGTGAANAATTTTTTAACCGTATTTGTTTTGTNAGGGAAACTAACAAGCAATGGAATTCNAAGAAGAAAGA AAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CcruzaQ_359: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16580893073608AA926472TENS1094T. cruzi epimastigote normalized cDNA Library
16888683115638AA952542TENS1477T. cruzi epimastigote normalized cDNA Library


Date: 23:18:6 on Mon 20 Nov 117.