CcruzaQ_3593


Sequence

>CcruzaQ_3593 (2 EST) Length=247 CAGAGAGAGAGAGAGGGAGAAAGGAAGAGAGGCACACATCCATTGACTCACTCTGTAAACTTCTCGCAGATAAAAAGGTA GAATGAGACAAAAACGGGGTAATTTCACAAAATCGCCTCCCGCTCATACTTAGCTGACAGTTTTTGGCCCATTTGTCCCC ATCACTAATTGACGTGGCGTTTCGCGCGACGCTCTCCCCGAGACGGACGGGCTCAGTCTCGTGAAGGAGAAACCGCTGCC GTCTTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CcruzaQ_3593: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17610533237460AI021847TENU0534T. cruzi epimastigote normalized cDNA Library
17855633294069AI046171TENU1258T. cruzi epimastigote normalized cDNA Library


Date: 8:16:15 on Wed 22 Nov 117.