CcruzaQ_376


Sequence

>CcruzaQ_376 (2 EST) Length=787 ATTCGGCACGAGGACTATATTGCCACTATTAGCATCATGGAGTTTGTTCCAACCTTTCANACTGCCGGCAAGGACCACGA ANTGTTTGTCAATCATGGCGGCGCGTACTGGCTCAACCCAGTACCGCACGGCACGTTCCGCTCACGCAGTGCATGCACCA TAATGAAGGCAACGGAAACCATTGACCCTTTCGGGAACCCCAAACNACCCGATAGGCCCATTGTGTTTGGACTGTCCCGG TACAGCACCGCCGAAAACAGGCTCAACGCCGCAAAACGGAAAACAAACGGTGATGACACCGAGATAGTGGAAGATAATAG GCGTGTCNAAGGGGTGACCAAAGGCGCGGATGCCGCTAGCGCGCATCCACGAATGCATACGGATAACAGGGACGAAGTTG ACTCTCATGACACTTTGCCCTTGCGTGCGCCGCCGTCTACCGACGCACGCAGTGCTAGAAACCACTGCTGTTAACGGTGA ACAAGGTGTCTTATTCAAGCGAAACCAATGGTTCCTGAGAAACTTCCACTTTGAAACCGCCAACCCTGAGCGCCGCATTT TGCATCCAGGCAATCACACGATCCGCATTCCTCCCACAGGTGGAACTGCGTACAATGGCACTGTCGGCGAGTCATGGACG GCACCGAGAGCAGTAGATGGAACCTATCTGCGTCTAGCCCCACTGTATGAGAGCACAACGCACTACCAGCTACGCACTGG CCCCTACAGAGGATGAGGCCCCGGCACACGGCATGACGCTACCGCCCAAAAGCTCTCTCCCTACACG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CcruzaQ_376: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16361863046227AA908155TENS0997T. cruzi epimastigote normalized cDNA Library
18416163421659AI083236TENU3914T. cruzi epimastigote normalized cDNA Library


Date: 2:33:35 on Thu 23 Nov 117.