CcruzaQ_392


Sequence

>CcruzaQ_392 (2 EST) Length=532 AATCGGCACGAGGCTTTTCCGCGCTCCACTCAGTTGGCCCTGTTTCGCCTCACGACGTTCGAGTCGGTGCTAAAGCTTTA CCGTTTGGCGCAGGAGCATCTTTCTGAATGCCTTTCGGCTTTTGAAGTGGTGGATGGCGAATCTCTCTCAGTCACTCCAC AGGAGGAGCTGCCTTTTACGCGAACAAGCAANAGTGATACGTTTCGCGCCGGCCAGGATTTCACCAGTGCATACTTCTGT GTTATGGTANANACAAATGGCAGTAATGCCGAGCACGACATGGAAAAACTCTCTCGTTTTGTGGAAGCTGCAGAGTGTAA CCCTCGCTGTGTTTCAAAAGGTGACTTGGGAGAATCATTTGAACCCGTCCTCTCACAATCGCTCGCACAGACGGCTCANC TGTGGAATCTGCGTGAGGACCCCCGGTACGGCTTGCTAATGCCGGGAACATCTACATATTTGACTCCGCTTTCCGCTTGA AAAATTTTAACAAATTGTGCTGCCTTTCCCCAGANGATCTACAAAAATGGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CcruzaQ_392: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16361403046181AA908109TENS0949T. cruzi epimastigote normalized cDNA Library
16888593115629AA952533TENS1468T. cruzi epimastigote normalized cDNA Library


Date: 17:7:19 on Wed 22 Nov 117.