CcruzaQ_393


Sequence

>CcruzaQ_393 (2 EST) Length=455 TTAATCGGCACGAGGGGGGAGTGGAGAGACCATTACGCTTGAGATGTGGATCGGCTTTCATCGTGTCATGCAATATGCCG ACGCGTTATCAGAGGCCGTGGAACTGTTCACCTCCTCAGGACTCCCTTTGCGGAGAAACGACTTCAACCGCGCAATAAGG GCCGCGGGTCTGCCACCTTTTGCCGATGCANAGTTGGACCTTATCATGGCCCTTTTTGACCGTAATGCAGATGGCGTTTT GGAGTTTGATGAGTTTATTTCCGTGATGCGGCAGAAGCTCAGCTACCACTACAGTTACCGCGGAGACCCNCGANAAAAGA AGAACTCCCCGTGCGTTTTTTCGAGTGCGTTGGTGAANTGTTGTCTCATTAGTTGGGCATTTTGCCTTTGTGTTGCATGT ATTTTCTATTTACCCCCTGGCTTTCCGTNTTTTGTTTTTTTGCTTCCCCCCTCTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CcruzaQ_393: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16361163046157AA908085TENS0925T. cruzi epimastigote normalized cDNA Library
16945363124112AA958155TENS1691T. cruzi epimastigote normalized cDNA Library


Date: 19:15:45 on Sun 19 Nov 117.