CcruzaQ_411


Sequence

>CcruzaQ_411 (2 EST) Length=478 AAATCGGCACGAGGGGCANAGACGCAAAATTTATGAAATGGGGAAAACAAATGCATCCCCTCTCGCCATCAAGGGGCANA CGGAGAAACTACGGGAAATGGAANTCNTGCANAAACATTTGGCCACCTTTCAAAAGCAAGANACATACTTTCGTCTCTTT AATGGATCGTTAGTCGCCTCCTTTTTGGCAACGTTTGATCTCCTTGACANAATTCTGCCATCACCGTCTCGGTATGTGCC GCAAGACTTTGCGCATGATTTGCCGTTCAAGCGGGTAGCAATGTTGGANGAGCCGGTGGTGTTTTTTAGGAACTGATGCT GTTCGACCACTGCTGTTTGCTTCTCTGTATTTGCATTGTTACTTCGTTCCCTTTTCACTTCATTCTGTTGTTCTCTGCGN CTCTCTCTCTCNCTGTGTGTGTGTCTGTGTGGGTGTGAATGACCCTCCCNTCCAATGGGGAAGAAGGTTNNAACTAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CcruzaQ_411: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16360933046134AA908062TENS0902T. cruzi epimastigote normalized cDNA Library
16945093124085AA958128TENS1664T. cruzi epimastigote normalized cDNA Library


Date: 17:42:37 on Tue 21 Nov 117.