CcruzaQ_424


Sequence

>CcruzaQ_424 (2 EST) Length=667 CAAGGAGAAAAGTGGAAGCAGTGGTGGATGTAGGGACACAGAATAATTAACTCTCAGTAGTCGACGCCAATAATAATAAT AATAATAATAATAAATAATATTAATAATAAGAATAATAGTAATAATAAAGCGCACACACACAGACAAAACAACAGATATA AAAAGGAAAAAAAAAAAAACAAAAGGAAAAGAGTGTAAAGAGTGTAAAGATGGAATGGCCAANTTCATCAAATATACTCC ATGGAATAACCAAACACCATNTTAATGGCATCAAAGAAATTTGCCCTCCATCCTTCCTGTACAACCTGCAACTCACCCTC AGGTATGCCAACCTGTGCAAATTCAAGTGTCACCACACCGGGTTCCTCCTTNTTCAGTGCCATTACCACGGAGCTGTGTA CACCGCTTGGCCAGGTACGGAGCCTCCACTGCATCTTAATCATAGCATTCGGCACCACCTCAACAAAAAAGCCGCTGATA ACCCCTCCAAGAAACCCTCAAACGTTCCACCAGATCGGGGATCAATTTTCGCCTGAGCCCGCGTGTACACCGATGCGCGC TTTTCATTCATGAGAACCGTAAAAAGNTTTTCAACAGGAATTCTCCAGCGCATTTTCCACGAAAAGCTTGTCGCTTCCGT GTCTTTGGAATCTGCCTCGTGCCGAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CcruzaQ_424: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16580073073526AA926390TENS1012T. cruzi epimastigote normalized cDNA Library
16945653124141AA958184TENS1720T. cruzi epimastigote normalized cDNA Library


Date: 0:47:9 on Wed 22 Nov 117.