CcruzaQ_430


Sequence

>CcruzaQ_430 (2 EST) Length=566 GTGGATTGGCAAGTACTAGGATTCAATAATGGCGTGGACGTGCTCGGCGTTATCTAATGCTTCAATGATCCAGAATCTGG AAAGGGCGGCGCTTCTGTCCACACCGGCGATCATCGCGTCACTTCAACGAGTGGATCGCGGGTGGTTTGTACCGGACGGT ATGCGGACTCGGCGTACAGGGACGAGCCGTTATCCCTTGGGCACGGTGCCACTATAAGTGCTCCTCATATGCACGCGATT ATGCTTGAACTTCTCTCTCCATTTTTGTTAAGTACTCCTGGGAGCTTGCCCAAGGCAGTTCTGGACATCGGCAGCGGTAG TGGTTATCTCACAGCCATCCTTGCTGACATCTGCGGGGATGGATCACGGGTAGTCGGTGTGGAGCACGTGGAAGAGTTAC AGGAACGTTCATTGAAGGTGGTTCTTCAACACTTTCCTAGCTGGGTGAATGAAAGGCCGCATTAACCTTCAACAATGGTG ACGGCAGAGACATATCAAAGTTATTTCATCCGAATACAGCCATGGTTGAAGTGATTCATGTCGGTGCAGCTGCCGCATCG GTTCCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CcruzaQ_430: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11767672275703AA532171TENF0273T.cruzi epimastigote normalized cDNA Library
18057573366414AI066249TENU2365T. cruzi epimastigote normalized cDNA Library


Date: 23:52:52 on Fri 17 Nov 117.