CcruzaQ_457


Sequence

>CcruzaQ_457 (3 EST) Length=532 CTCAAAGCCCAAGACACGGCACTTCAGCGTCGACTCAATGAAATGTCGGCGTACCTGAATACGCTTAGTGAGGCGGAGGT ACTGGAGCGCACCTTTGGCACCCGTTTTGCGCCCATCACAGGGAGTCAGAAGGCAGACACTGTGAAGGACTCCACACGGC AATTTAAATTACTGCGTGCGAGAAATGTGTTGGGCCCAAAAGAGGCGCAGGCGGTGGAATTTGATGCGTATGGCAACGCC GTCTCGCTGTACCTCACGGAGGGGGCCAAATGGCGTCGTTTCAAGATGGTGATTGAAAAGCTTCGGCGGATGCCGCCACG CTCGGCGGAGAGTTATGACATTTGGGGCCGTGTAGGCCTCGCACTGCACAAGTTCAGCAACGAGGACCACGTCTTTTAGG AATAGGTGCGGTTTCTTCGCTCAAGTGTCCCCGGAAATACTTCACGCGGTTATGCCGGAAAAATGGCAACAGTTTGAGCG CAACCCTGACGCACTGAACTGGCGCCGTGGATTCAATTACTTAAACACCACC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CcruzaQ_457: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6786941542834D87315D87315Trypanosoma cruzi Y (Tomoo Tanaka)
6786951542835D87316D87316Trypanosoma cruzi Y (Tomoo Tanaka)
6786961542836D87317D87317Trypanosoma cruzi Y (Tomoo Tanaka)


Date: 12:0:33 on Fri 24 Nov 117.