CcruzaQ_471


Sequence

>CcruzaQ_471 (2 EST) Length=739 AAAGGAAGCATTNTTGTTTGTCAGNGGGNGGAAAGTGTTTTTANGGNGGGGTAAACGAGAAGTGAATCCCGTAAAGTAAT ATAGGAGTCAAAGATAATATGTTCTTTTGCGGGGCCTTGTCGCCACTTTTCNTTCCAAAATGGGAGGAGGGGAGCAGCAG GGGAAGTCCACAGTTCGGTTCCGTGCGCCCAACCTCCCCCACACTCCAGAGAAGACATGCCCCACGNTCANACACCAGCA AAACGATTGGTCCATACATNGNTTTTTGACGGCCGGGACCGTTGTGGGCTCACGAGGCAGCACTTTTTGAAAGGGCCCCA CAGCCGCCGGTGATCCCCACCGAGCGGAAGGTAACAAAAATAGGAGTGGGTGGAAGTGCACCGCAAAACAACTGCACCCG CCGCCCTTCAACGCGTTATTTTTTTTTTTTTTTGAAGAAATTAAAATAATAAAAAAGTAACAAATTACGGTAAAAAACAA AAAAAAAAACAAATTTGCCTTCTTTNTCTTCTCGCTTCACTGCCGAATTATTTAGCAGCATATAAACACGAACTCCCTNT CCACGNTTGTAAATAAAAGTGTCAANTTATTGTTACAGTCCATGCCGCCTGTCAGATNGTTTTGTGTAGACTTATATATA TATATATATATAGATATAGATATAAACGATATAATTCGCATTAATCACGCTGTTTGTTGTCTGTCATCTGTCTGTAGCGT ACAGTCGNCCTCACTTACT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, Processing,


Cluster Information for CcruzaQ_471: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16098172991966AA882855TENS0430T. cruzi epimastigote normalized cDNA Library
16581253073644AA926508TENS1130T. cruzi epimastigote normalized cDNA Library


Date: 0:38:4 on Thu 23 Nov 117.