CcruzaQ_482


Sequence

>CcruzaQ_482 (2 EST) Length=527 AATTCGGCACGAGGGCTCTACGGGTCTTGTGTGTCATTTTAAGTATTCCGCTTCCCAAGAGCCGCAGCAAAATGACGCTC TACAGTACTCTTGCCAGCTTTCACTACACGCATTGTGAGAAACTTGGCAAACGTGTCTCGAGCTCCCACAATGTGCAGGC ACAGCTGAAGCGCGACGAACAGATGATTCAAAAATTGTTTCCAGCGGGTTCCACATCCCAGACAAATTCAGGTATGGGAA GAAACAGCAGCAGCAGGAGCAACAACAACAACAACTGCATCGCGACCATCAGGCATCACCAAAACTGTTAATTCTACCAC TCTCAGCAAACACAGCAACAGCAGTTGTACCGATAAAAATGCTAGTAATGGCAGTGCCAACCACAAGAAGGGCACTCGCT CCATGCTAACTGCTGTGGACAGCAATGTTTCCCCTCTAGATGACACTCCACGGAGTCGCAGAAGGAAGCTGGTTTCCCAA TACCGGGGGCGAAACCACAAAAAAAATCTCCCCTTGGAAAAGGATGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CcruzaQ_482: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11767512275687AA532111TENF0470T.cruzi epimastigote normalized cDNA Library
16581163073635AA926499TENS1121T. cruzi epimastigote normalized cDNA Library


Date: 0:27:0 on Thu 23 Nov 117.