CcruzaQ_489


Sequence

>CcruzaQ_489 (4 EST) Length=529 TGCGGCGGATAACGTACTTGCGCACGTCGTCGCCGCGGGAGAGGTTGAAGAGCTTGCGGATCTTGTTCGCACGCTTTGGA CCGAGGCGGCGAGGCACCGACACGTCAGTAACACCCTCAATTGGCTGCTCGCCGGTTTTCACAATGACGACATTCAGCAC CGCAATGTCGCTCGCGAGGACGCAGCCACGGACAGACTTGCGGCGGCGCTCGCCCTGATACCCGCGGAAGGTGTTGAAGC CGACGGCGCCCCGCTTCACGAGGAGCGACACACGACTTGGCGCCATGACACCCTGCACCATCGGGAAGCCCTGCTTGTCG GAGCCGCCCTGCAGCTTGAAGGTGTATCCCCTGAAGGCATCACCAAAGATGGCCCCGTCAACCTCGTTGCCGAGACGGTA GTCCGTCAGCGACACGCGGCGGAGCACCTCCTCGGTGATCTCGAACTGCTTGACGGTCCCGTTGCGGGGGTAGGCGATGT TAAGCTTCATTGTGTTGGCTCAAGGAGTTGCAATATAGCCTACAGAAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CcruzaQ_489: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10709652107909AA426672TEUF0204T.cruzi epimastigote non-normalized cDNA Library
15941202963376AA867931TENS0038T. cruzi epimastigote normalized cDNA Library
17971143331529AI057663TENU1753T. cruzi epimastigote normalized cDNA Library
18245153392753AI069778TENU2849T. cruzi epimastigote normalized cDNA Library


Date: 23:19:53 on Sun 19 Nov 117.